Multiple Sclerosis Resource Centre

Welcome to the Multiple Sclerosis Resource Centre. This website is intended for international healthcare professionals with an interest in Multiple Sclerosis. By clicking the link below you are declaring and confirming that you are a healthcare professional

You are here

Vitamin D supplementation up-regulates IL-6 and IL-17A gene expression in multiple sclerosis patients

International Immunopharmacology, Volume 28, Issue 1, September 2015, Pages 414 - 419

Abstract

Vitamin D regulates gene expression and affects target cell functions. IL-6 and IL-17A are pro-inflammatory cytokines associated with MS pathogenesis. The aim of this study was to investigate the vitamin D effects on the expression level of IL-6 and IL-17A in peripheral blood mononuclear cells (PBMCs) of multiple sclerosis (MS) patients. Also, we performed a correlation analysis between the gene expression and some clinical features such as serum level of vitamin D and the expanded disability status scale (EDSS). Significant up-regulation of IL-6 and IL-17A gene expression was shown under vitamin D treatment. Also, some gender specific correlations between the gene expression with vitamin D levels were detected in female RR-MS patients.

Highlights

 

  • IL-6 and IL-17A gene expression up-regulate under vitamin D treatment.
  • No correlation was observed between EDSS scores with IL-6 and IL-17A expression.
  • Some MS patients are not responsive to vitamin D supplementation.
  • Personalizing medicine can tell why some MS patients do not respond to vitamin D supplementation.

Keywords: Multiple sclerosis, Vitamin D, IL-17A, IL-6, EDSS, Gene expression.

1. Introduction

Multiple sclerosis (MS) is an inflammatory and neurodegenerative disease that is characterized by lesions in the central nervous system (CNS) [1] . It is estimated that 2.5 million people suffer from MS worldwide [2] . It appears that demyelinating of CNS is caused by T cell mediated autoimmune processes [3] . The etiology and pathogenesis of MS are poorly understood but, MS susceptibility is affected by genes and environmental factors [1] such as vitamin D level, which is thought to play an immunomodulatory role in the CNS [4] . Also, some studies indicated that high serum levels of vitamin D are associated with a lower risk of autoimmune diseases like MS [5] . The potential role of vitamin D and its bioactive metabolite 1, 25 (OH)2 D3 in the regulation of immune responses is recognized with vitamin D receptor (VDR). VDR presents in macrophages, dendritic cells, and activated T and B lymphocytes. Function and proliferation of these cells can be regulated by 1, 25 (OH) 2 D3. The ability of 1, 25 (OH)2 D3 for regulating of immune responses has clinical utility in the prevention of some autoimmune diseases in animal and human models [6] . VDR stimulates transcription of some various genes to alter the cellular function [7] . Moreover, VDR presents in the CNS and the 1α hydroxylase activity is shown in neurons and microglia which emphasize that vitamin D (VD) has local, auto and paracrine effects in the CNS [2] .

1, 25 (OH)2 D3 represses the transcription of some pro-inflammatory cytokines such as IL-2, decreases T-cells and dendritic cells maturation, proliferation and differentiation [8] . VD has an immune-modulatory effect which alters the balance between T helper 1 (Th1) and T helper 2 (Th2) in favor of Th2 cells [1], [6], and [9]. Also, the protective role of vitamin D in the prevention of EAE has been shown. VD has an anti-inflammatory and protective effect on the myelin by activating oligodendrocytes in the EAE model. Calcitriol has some effects on the B cells, including inhibition of proliferation, differentiation and apoptosis of plasma and memory cells and decreasing of immunoglobulin production [10] .

Th17A, a new class of inflammatory T helper cells produces IL-17 that plays critical role in autoimmune diseases, including rheumatoid arthritis, systemic Lupus erythematous and MS [11] and [12]. This cytokine is produced by activated T cells and regulates activities of NF-KB and mitogen-activated protein kinases. The expression of IL-6 can be stimulated by IL-17A which also enhances the production of nitric oxide (NO). In autoimmune diseases such as rheumatoid arthritis, psoriasis and MS, higher level of IL-17A has been shown [13] .

IL-6 is a multi-potential cytokine that plays central role in host defense such as the immune responses, hematopoiesis and acute phase reactions [14] and [15]. It is a B cell differentiation factor that can induce maturation of B cells to plasma cells. IL-6 has various physiological and pathophysiological functions in the immune system and CNS. This cytokine plays some important roles in the neurogenesis and neuron and glial cell maturation in normal conditions. It is regulated by inflammatory cytokines, neurotransmitters and neuropeptides in the brain cells. The induction of IL-6 is carried out by TNF-α, IL-1β, NF-KB and PKC pathways in astrocytes which their role in the MS pathogenesis indicated previously [15], [16], and [17]. Numerous studies claim that both gliogenesis (through STAT-3 pathway) and neurogenesis (MAPK/CREB pathway) are induced by IL-6 [16] . Peripheral blood mononuclear cells produced significant reduction in the IL-6 level with high dose of VD supplementation in healthy people [10] . IL-6 and IL-23 stimulate the differentiation of Th17 cells which leads to produce IL-17A [13] . IL-6 is a linking arm between T and B cell responses and a triggering factor for IL-17 production [18] and [19]. The inhibitory effect of IL-6 on the negative regulation of Th17 cells was indicated which is a positive feedback regulator for inflammation [20] .

The molecular mechanisms of the role of vitamin D on the expression of IL-6 and IL-17A genes were not completely determined. Also, the mechanisms underlying the role of cytokines' functions on the EDSS score were slightly known. Hence, we investigated the effects of 25-hydroxyvitamin D treatment on the mRNA expression of IL-6 and IL-17A genes in the PBMCs in vivo to understand basis and effectiveness of VD supplementation on some pro-inflammatory proteins involved in MS pathogenesis.

2. Material and methods

2.1. Patients

Design of sample selection and treatments described in our previous publication [21] . Briefly, thirty two RR-MS patients were selected from MS Research Center of Sina Hospital at Tehran University of Medical Sciences (Tehran, Iran) during November 2012 to October 2013 by a certified neurologist, according to Poser's and MacDonald's criteria [22] and [23]. Treatment group (cases) received an oral dose of 50,000 IU of vitamin D every week for 2 months. Informed consent was obtained from all patients and this study was approved by the institution ethical committee and the medical ethics committee of Tarbiat Modares University. Before and after treatment with VD, whole blood samples were obtained from selected patients and the amount of VD was determined immediately after serum separation, as described previously [21] by ELISA kit according to the manufacturer's instructions (Immuno diagnostic Systems, Inc. Fountain Hills, AZ).

2.2. RNA extraction and cDNA synthesis

Five milliliters of blood samples was collected in the anti-coagulant EDTA tubes. White blood cells were isolated using Ficoll solution (lympholyte, Cedarlane, Netherlands) gradient by centrifugation for 20 min and 3000 rpm at 4 °C. Total RNA was extracted based on acid guanidinium–phenol-chloroform procedure using RNX™-plus reagent (CinnaGen, IRAN) according to the manufacturer's instructions. RNAs was treated with DNAase I (Fermentas, Lithuania) for the elimination of any genomic DNA contamination. Concentration, integration and purity of RNA samples were determined by spectrometry and gel electrophoresis. 3 μg of total RNA was used for cDNA synthesis with random hexamer and oligo (dT)18 primers through RevertAid™ Reverse Transcriptase (Fermantase, Canada) in total 20 μl reaction mixture.

2.3. Real-time PCR analysis

Appropriate primers for IL-6 (Forward: CCAATCTGGATTCAATGAGGAG & Reverse: GGTCAGGGGTGGTTATTGCATC), IL-17: (Forward: CTTCCCCCGGACTGTGATGGTCAA & Reverse: TCATGTGGTAGTCCACGTTCCCAT) and Glyceraldehyde-3 phosphate Dehydrogenase (GAPDH) (Forward: CCATGAGAAGTATGACAAC & Reverse: GAGTCCTTCCACGATACC) – as an internal control – were designed. Quantitative Real-time PCR was performed by ABI 7500 sequence detection systems (Applied Biosystem/MDS SCIEX, Foster City, CA, USA) using 4 μl of 5 × EVA GREEN I master mix (Salise Biodyne, Japan), 10 ng cDNA, 200 nM of each forward and reverse primers in final volume of 20 μl. The PCR was performed through the following instruction: an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s. The specificity of PCR products was evaluated by 12% polyacrylamide gel electrophoresis and melting curve analysis. All experiments were performed at least in duplicate.

2.4. Statistical analysis

Statistical analysis was done using SPSS Version 16.0 Software (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 6 (GraphPad Software, Inc., San Diego, CA, USA). Paired Student's t test was used for comparison of gene expression before and after supplementation with vitamin D. Wilcoxon signed rank test was used for analysis of EDSS scores. Pearson's correlation coefficient and standard regression test were used for correlation analysis results. Two-tailed p values < 0.05 were considered significant, and data were shown as mean ± standard deviation (SD). Relative mRNA expression normalized to GAPDH was calculated by ΔΔCT method (23) and the fold change expression of each gene was calculated by ratio formula (ratio = 2− ΔΔCT).

3. Results

3.1. Clinical characteristics of patients

The mean age of patients was 30.68 ± 7.2 (ranging from 22 to 52) years, and the mean disease duration was 5.65 ± 3.8 years (ranging from 1 to 14). In our samples, we had 6 males and 26 females and all of them were RR-MS which 15% had familial history. RRMS patients were categorized by difference in serum levels of 25(OH)2 D3 before and after treatment. After 8 week supplementation of 32 patients, we found that 24 MS patients were responsive to VD (∆vitD3 ≥ 20) but 8 MS patients were non-responsive (∆vitD3 < 20). In non-responsive patients the level of VD did not reach to the standard level (> 20 nm) and surprisingly in some cases this level decreased. As reported before, after 8 week treatment with vitamin D, the EDSS scores of MS patients decreased from a mean of 2.21 ± 1.03 to 1.96 ± 1.05 (p = 0.002). All demographic and clinical characteristics of the MS patients are presented in Table 1 .

Table 1 Some clinical features of the patients with multiple sclerosis (ΔvitD3 = serum levels of 25(OH) vitamin D3 after treatment − serum levels of 25(OH) vitamin D3 before treatment).

  Number Total Females Males ∆vitD3 < 20 non-responsive to VD ∆vit D3 ≥ 20 responsive to VD
32 26 6 8 24
Multiple sclerosis patients Onset age (mean ± SD) 30.68 ± 7.13 29.73 ± 5.8 34.83 ± 11.42 33 ± 10.12 29.91 ± 6.09
MS duration (mean ± SD) 5.65 ± 3.8 5.96 ± 3.7 4.33 ± 4.17 8.12 ± 4.7 4.83 ± 3.15
EDSS before treatment (mean ± SD) 2.21 ± 0.99 2.09 ± 0.82 2.75 ± 1.57 2.18 ± 1.60 p = 0.03 2.22 ± 0.7 p = 0.015
EDSS after treatment (mean ± SD) 1.96 ± 1.1 1.78 ± 0.76 2.75 ± 1.60 1.93 ± 1.42 1.97 ± 0.87

3.2. The effect of VD on IL-6 and IL-17A gene expression

Our study indicated that, IL-6 and IL-17A mRNA expression levels were increased significantly after vitamin D treatment (p = 0.004 (4 fold), p = 0.015 (3.8 fold) respectively) ( Fig. 1 a & b). Also, the expression of IL-6 and IL-17A was significantly increased in ∆vitD3 ≥ 20 group (p = 0.013 (4.4 fold), p = 0.02 (4.7 fold) respectively) ( Fig. 1 c & d), but not in ∆vitD3 < 20 group (p = 0.16, p = 0.31 respectively) ( Fig. 1 e & f). Also, based on EDSS scores, we categorized MS patients in two groups EDSS ≤ 2 and EDSS > 2. The IL-6 mRNA expression level was significantly increased in patients with EDSS > 2 (p = 0.014) but no significant differences was identified in this group for IL-17A (p = 0.10). Moreover, these differences for two genes were not significant in patients with EDSS ≤ 2 (p = 0.08, p = 0.07 respectively). In stratification for gender, significant differences of IL-6 and IL-17A expressions were observed before and after treatment with VD only in females (p = 0.004 (4.2 fold), 0.013 (4.1 fold) respectively) ( Fig. 1 g & h), but this difference was not significant in males (p = 0.44, 0.57 respectively).

gr1

Fig. 1 Gene expression levels of IL-6 (a) and IL-17A (b) in multiple sclerosis patients before and after 8 week treatment with vitamin D. Analysis of IL-6 (c) and IL-17A (d) expression levels before and after treatment with vitamin D in patients with Δvit D ≥ 20. Analysis of IL-6 (e) and IL-17A (f) expression levels before and after treatment with vitamin D in patients with Δvit D < 20. Analysis of IL-6 (g) and IL-17A (h) expression levels in female group before and after treatment with vitamin D. All expression analysis was normalized to the level of GAPDH expression as an internal control.

3.3. Correlation analysis of gene expression with clinical features

There was no significant correlation between IL-6 expression level and age (r = 0.13, p = 0.45), disease duration (r = 0.17, p-value = 0.34), EDSS score (r = 0.11, p-value: 0.52) and vitamin D serum level (r = − 0.25, p = 0.88). Also, no significant correlation was observed between IL-17A expression levels with EDSS score (r = 0.24, p = 0.17), age (r = 0.21, p-value: 0.24), disease duration (r = 0.28, p = 0.11) and 25-hydroxyvitamin D serum level (r = 0.09, p-value: 0.62). But, significant correlations between EDSS scores with age (r = 0.35, p = 0.04) and disease duration (r = 0.42, p-value = 0.006) were observed ( Fig. 2 a & b). Interestingly, the expression level of IL-6 was correlated with the expression of IL-17A (r = 0.9, p = < 0.0001) ( Fig. 2 c).

gr2

Fig. 2 EDSS scores were correlated with disease duration (a) and age (b) before treatment. (c) The IL-6 level correlated positively with IL-17A level in PBMCs before treatment.

4. Discussion

Autoimmune diseases such as MS are believed to be associated with overproduction of proinflammatory cytokines, including IL-2, IL-6, and TNF-α [18] . Production of TNF-α, IL-6 and NO is inhibited in EOC13 microglial cell line by vitamin D administration, indicating direct anti-inflammatory role of 1, 25(OH)2D3 on microglia cells [24] . The aim of this study was the evaluation of the role of 8 week vitamin D treatment on the expression level of IL-6 and IL-17A in PBMCs of MS patients. Interestingly and in opposite to some other clinical trials, our results showed that the expression levels of two studied genes were significantly increased [21] .

Production of pro-inflammatory mediators such as IL-6, IL-8 and GM-CSF leads to over production of IL-17A which in turn down-regulation of IL-17A is associated with a decrease of production of IL-6 and other pro-inflammatory cytokines in Rheumatoid Arthritis (RA) [25] . In opposite to our results, calcitriol was found to suppress directly IL-17 on the transcription level [11] . Also, Correale et al. have reported that vitamin D caused increased number of IL-10 producing T cells, decreased numbers of IL-6 and IL-17 producing cells and inhibited IL-17 production in both patients and controls [19] . IL-17A is secreted from Th17 cells and has important functions in host defense and pathogenesis of autoimmune diseases like MS [18] . Th17 secretes IL-17A, IL-17F, IL-21 and IL-22, of which IL-17A and IL-17F mediate many of the pathologic functions of these cells. Tissue damage and exacerbate pro-inflammatory responses during autoimmunity are mediated by IL-17 [26] . Vitamin D also affects activated T cells and leads to significant decrease in the level of IL-17 production [10] . IL-17 and IL-22 disrupt the tight junctions of blood brain barrier (BBB), resulted in migration of Th17 cells into the CNS and cause neuronal damage [27] .

IL-6 expression increases following axonal damage, especially in neurons and its up-regulation is shown in neuroinflammation of the CNS [16] which induced T cell proliferation and infiltration into the CNS. T cell differentiation into TH17 cells is induced by IL-6 in the presence of TGF-β which TH17 cells secrete IL-17 that stimulates IL-6 induction in astrocytes in a positive feedback. Also, we found a positive correlation between the expressions of IL-6 with IL-17A. Production of IL-6, nitric oxide (NO), and reactive oxygen species (ROX) is induced by T cells which directly contact with astrocytes and lead to damaged myelin sheathes and neurons in MS [16] . Lower dose of VD, short period of supplementation, type of samples and genetic background of our patients may lead to different results in our study. Moreover, we investigated the expression of genes in PBMCs but, another studies measured them in serum or some other sorted cells. In agreement with Pahlevan Kakhki et al. [28] , we think that heterogeneous combination of cells in whole blood may overshadow some aspects of our results which should be more studied. We found a gender specific difference between the expression of IL-6 and IL-17A before and after treatment with VD. Gender specific prevalence of MS might be associated with differences in the sexual hormones between males and females [28] and [29]. Sexual hormones, response to infection and sex differences in genetic factors might be important in sex bias of autoimmune disease such as MS [30] .

No significant correlation was observed between EDSS scores with IL-6 and IL-17A expression. As reported previously, we found a reverse correlation between EDSS scores with vitamin D supplementation which appears that, vitamin D reduces disability of MS patients. Yusupov et al. indicated seasonal differences in vitamin D level causes changes in the cytokine levels at winter and summer [10] and [31]. Some of our samples obtained in winter and some other in summer which may affect our results. Golan investigated vitamin D supplementation for MS patients treated with interferon β and determined EDSS, PTH, IL-17, IL-10 and IFN-Y in a randomized, double blind study. 21 patients took 800 IU vitamin D3 per day (low dose) and 24 patients received 4370 IU per day (high dose). In agreement with our results, IL-17 serum levels were significantly increased in low dose group, but the patients were taking high dose vitamin D had heterogeneous IL-17 responses [32] . These evidences showed that the dose of VD may affect our results that must be considered in future studies. Arababadi observed a significant increase of IL-17 serum levels in patients treated with Cinnovex and Anovex [33] . Also, Nicoletti et al. showed increasing of IL-6 levels with short term IFN-1β treatment in RRMS patients [34] . Some of patients contributing in our study were taking these drugs which may interfere with our data. Our limitation was as follows: There was no placebo-control group in our study and the sample size of our study was small. Study of the effect of vitamin D in a longer period supplementation with different doses may help us to indicate precise roles of vitamin D in the MS. Here we don't have any explanation for patients who were non-responsive to vitamin D but, we think that personalizing medicine may shed further light on this issue. In conclusion, we found that vitamin D may have a pleiotropic role in MS pathogenesis which showed further studies may be needed to elucidate the precise molecular mechanisms of VD in multiple sclerosis.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgments

We sincerely thank the patients and institution in this study. The Iran National Science Foundation and the Department of Research Affairs of Tarbiat Modares University provide the funding of this work.

References

  • [1] A.M. Burrell, A.E. Handel, S.V. Ramagopalan, G.C. Ebers, J.M. Morahan. Epigenetic mechanisms in multiple sclerosis and the major histocompatibility complex (MHC). Discov. Med.. 2011;11:187-196
  • [2] J. Dörr, A. Döring, F. Paul. Can we prevent or treat multiple sclerosis by individualised vitamin D supply. EPMA J.. 2013;4:1-12
  • [3] T. Tuller, S. Atar, E. Ruppin, M. Gurevich, A. Achiron. Global map of physical interactions among differentially expressed genes in multiple sclerosis relapses and remissions. Hum. Mol. Genet.. 2011;20:3606-3619 Crossref
  • [4] P. Casaccia-Bonnefil, G. Pandozy, F. Mastronardi. Evaluating epigenetic landmarks in the brain of multiple sclerosis patients: a contribution to the current debate on disease pathogenesis. Prog. Neurobiol.. 2008;86:406-416 Crossref
  • [5] K.M. Spach, L.B. Pedersen, F.E. Nashold, T. Kayo, B.S. Yandell, T.A. Prolla, et al. Gene expression analysis suggests that 1, 25-dihydroxyvitamin D3 reverses experimental autoimmune encephalomyelitis by stimulating inflammatory cell apoptosis. Physiol. Genomics. 2004;18:141-151 Crossref
  • [6] J. Smolders, J. Damoiseaux, P. Menheere, R. Hupperts. Vitamin D as an immune modulator in multiple sclerosis, a review. J. Neuroimmunol.. 2008;194:7-17 Crossref
  • [7] C.E. Hayes. Vitamin D: a natural inhibitor of multiple sclerosis. Proc. Nutr. Soc.. 2000;59:531-535 Crossref
  • [8] M. Olliver, L. Spelmink, J. Hiew, U. Meyer-Hoffert, B. Henriques-Normark, P. Bergman. Immunomodulatory effects of vitamin D on innate and adaptive immune responses to Streptococcus pneumoniae. J. Infect. Dis.. 2013;208:1474-1481 Crossref
  • [9] L.A. Zella, M.B. Meyer, R.D. Nerenz, S.M. Lee, M.L. Martowicz, J.W. Pike. Multifunctional enhancers regulate mouse and human vitamin D receptor gene transcription. Mol. Endocrinol.. 2010;24:128-147 Crossref
  • [10] B. Prietl, G. Treiber, T.R. Pieber, K. Amrein. Vitamin D and immune function. Nutrients. 2013;5:2502-2521 Crossref
  • [11] S. Joshi, L.-C. Pantalena, X.K. Liu, S.L. Gaffen, H. Liu, C. Rohowsky-Kochan, et al. 1, 25-Dihydroxyvitamin D3 ameliorates Th17 autoimmunity via transcriptional modulation of interleukin-17A. Mol. Cell. Biol.. 2011;31:3653-3669 Crossref
  • [12] S. Zhu, Y. Qian. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic potential. Clin. Sci.. 2012;122:487-511 Crossref
  • [13] Y. Arnson, H. Amital, Y. Shoenfeld. Vitamin D and autoimmunity: new aetiological and therapeutic considerations. Ann. Rheum. Dis.. 2007;66:1137-1142 Crossref
  • [14] S. Hubackova, K. Krejcikova, J. Bartek, Z. Hodny. Interleukin 6 signaling regulates promyelocytic leukemia protein gene expression in human normal and cancer cells. J. Biol. Chem.. 2012;287:26702-26714 Crossref
  • [15] R.J. Simpson, A. Hammacher, D.K. Smith, J.M. Matthews, L.D. Ward. Interleukin‐6: structure–function relationships. Protein Sci.. 1997;6:929-955 Crossref
  • [16] M. Erta, A. Quintana, J. Hidalgo. Interleukin-6, a major cytokine in the central nervous system. Int. J. Biol. Sci.. 2012;8:1254 Crossref
  • [17] M. Heidary, N. Rakhshi, M.P. Kakhki, M. Behmanesh, M.H. Sanati, N. Sanadgol, et al. The analysis of correlation between IL-1B gene expression and genotyping in multiple sclerosis patients. J. Neurol. Sci.. 2014;343(1-2):41-45
  • [18] Bolaños-Jiménez R, Arizmendi-Vargas J, Carrillo-Ruiz J, López-Lizárraga M, Serrato-Ávila J, Rendón-Molina A, et al. Multiple sclerosis: An overview of the disease and current concepts of its pathophysiology. Journal of Neuroscience and Behavioural Health.3:44–50
  • [19] J. Correale, M.C. Ysrraelit, M.I. Gaitán. Immunomodulatory effects of vitamin D in multiple sclerosis. Brain. 2009;132(Pt 5):1146-1160 Crossref
  • [20] M.T. Kampman, L.H. Steffensen. The role of vitamin D in multiple sclerosis. J. Photochem. Photobiol. B Biol.. 2010;101:137-141 Crossref
  • [21] B. Naghavi Gargari, M. Behmanesh, M.A. Sahraian. Effect of vitamin D treatment on interleukin-2 and interleukin-4 genes expression in multiple sclerosis. Physiol. Pharmacol.. 2015;19(1):PP14-PP21
  • [22] C.H. Polman, S.C. Reingold, B. Banwell, M. Clanet, J.A. Cohen, M. Filippi, et al. Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria. Ann. Neurol.. 2011;69:292-302 Crossref
  • [23] K.J. Livak, T.D. Schmittgen. Analysis of relative gene expression data using real-time quantitative PCR and the 2 − ΔΔCT method. Methods. 2001;25:402-408 Crossref
  • [24] A.T. Slominski, T.-K. Kim, W. Li, A.-K. Yi, A. Postlethwaite, R.C. Tuckey. The role of CYP11A1 in the production of vitamin D metabolites and their role in the regulation of epidermal functions. J. Steroid Biochem. Mol. Biol.. 2014;144:28-39
  • [25] S.-Y. Hwang, J.-Y. Kim, K.-W. Kim, M.-K. Park, Y. Moon, W.-U. Kim, et al. IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-kappaB-and PI3-kinase/Akt-dependent pathways. Arthritis Res. Ther.. 2004;6:R120-R128 Crossref
  • [26] E.S. Hwang, D.W. Kim, J.H. Hwang, H.S. Jung, J.M. Suh, Y.J. Park, et al. Regulation of signal transducer and activator of transcription 1 (STAT1) and STAT1-dependent genes by RET/PTC (rearranged in transformation/papillary thyroid carcinoma) oncogenic tyrosine kinases. Mol. Endocrinol.. 2004;18:2672-2684 Crossref
  • [27] R.M. Onishi, S.L. Gaffen. Interleukin‐17 and its target genes: mechanisms of interleukin‐17 function in disease. Immunology. 2010;129:311-321 Crossref
  • [28] M. Pahlevan Kakhki, N. Rakhshi, M. Heidary, M. Behmanesh, A. Nikravesh. Expression of suppressor of cytokine signaling 1 (SOCS1) gene dramatically increases in relapsing–remitting multiple sclerosis. J. Neurol. Sci.. 2015;350:40-45
  • [29] Z. Bahadori, M. Behmanesh, M.A. Sahraian. Two functional promoter polymorphisms of neuregulin 1 gene are associated with progressive forms of multiple sclerosis. J. Neurol. Sci.. 2015;351:154-159
  • [30] C.C. Whitacre. Sex differences in autoimmune disease. Nat. Immunol.. 2001;2:777-780 Crossref
  • [31] E. Yusupov, M. Li-Ng, S. Pollack, J.K. Yeh, M. Mikhail, J.F. Aloia. Vitamin D and serum cytokines in a randomized clinical trial. Int. J. Endocrinol.. 2010;2010:1-7 Crossref
  • [32] D. Golan, B. Halhal, L. Glass-Marmor, E. Staun-Ram, O. Rozenberg, I. Lavi, et al. Vitamin D supplementation for patients with multiple sclerosis treated with interferon-beta: a randomized controlled trial assessing the effect on flu-like symptoms and immunomodulatory properties. BMC Neurol.. 2013;13:60 Crossref
  • [33] M.K. Arababadi, R. Mosavi, H. Khorramdelazad, N. Yaghini, E.R. Zarandi, M. Araste, et al. Cytokine patterns after therapy with Avonex®, Rebif®, Betaferon® and CinnoVex™ in relapsing–remitting multiple sclerosis in Iranian patients. Biomark. Med.. 2010;4:755-759 Crossref
  • [34] F. Nicoletti, R. Di Marco, F. Patti, P. Zaccone, M.R. L'Episcopo, E. Reggio, et al. Short-term treatment of relapsing remitting multiple sclerosis patients with interferon (IFN)-β1B transiently increases the blood levels of interleukin (IL)-6, IL-10 and IFN-γ without significantly modifying those of IL-1β, IL-2, IL-4 and tumour necrosis factor-α. Cytokine. 2000;12:682-687 Crossref

Footnotes

a Department of Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran

b MS Research Center, Neuroscience Institute, Tehran University of Medical Science, Tehran, Iran

Corresponding author at: Department of Genetics, Faculty of Biological Sciences, Tarbiat Modares University, P.O. Box: 14115-154 Tehran, Iran.


Search this site

Stay up-to-date with our monthly e-alert

If you want to regularly receive information on what is happening in MS research sign up to our e-alert.

Subscribe »

About the Editors

  • Prof Timothy Vartanian

    dsc_0787_400x400.jpg Timothy Vartanian, Professor at the Brain and Mind Research Institute and the Department of Neurology, Weill Cornell Medical College,...
  • Dr Claire S. Riley

    headshotcsr1_185x250.jpg Claire S. Riley, MD is an assistant attending neurologist and assistant professor of neurology in the Neurological Institute, Columbia...
  • Dr Rebecca Farber

    picforelsevier.jpg Rebecca Farber, MD is an attending neurologist and assistant professor of neurology at the Neurological Institute, Columbia University, in...

This online Resource Centre has been made possible by a donation from EMD Serono, Inc., a business of Merck KGaA, Darmstadt, Germany.

Note that EMD Serono, Inc., has no editorial control or influence over the content of this Resource Centre. The Resource Centre and all content therein are subject to an independent editorial review.

The Grant for Multiple Sclerosis Innovation
supports promising translational research projects by academic researchers to improve understanding of multiple sclerosis (MS) for the ultimate benefit of patients.  For full information and application details, please click here

Journal Editor's choice

Recommended by Prof. Brenda Banwell

Causes of death among persons with multiple sclerosis

Gary R. Cutter, Jeffrey Zimmerman, Amber R. Salter, et al.

Multiple Sclerosis and Related Disorders, September 2015, Vol 4 Issue 5