Multiple Sclerosis Resource Centre

Welcome to the Multiple Sclerosis Resource Centre. This website is intended for international healthcare professionals with an interest in Multiple Sclerosis. By clicking the link below you are declaring and confirming that you are a healthcare professional

You are here

Mitochondrial DNA T4216C and A4917G variations in Multiple Sclerosis

Journal of the Neurological Sciences (Available online 7 May 2015)

Abstract

Background

Multiple Sclerosis (MS) affects the brain and spinal cord and long has been the topic of global research; yet there is no commonly accepted cause and no cure for the disease. Mounting evidence supports the role of genetics in susceptibility to MS. From this perspective, a current effort focuses on the neurogenetics of the complex pathogenesis of MS in relation to factors such as mitochondrial DNA (mtDNA) variations. T4216C and A4917G are common mitochondrial gene variations associated with MS. The present study tested whether mtDNA T4216C variation in the NADH Dehydrogenase 1 (ND1) mtDNA gene and A4917G variation in the mtDNA NADH Dehydrogenase 2 (ND2) gene is associated with MS in an Iranian population.

Material and Methods

Blood samples were collected from 100 patients with MS and 100 unrelated healthy controls, and DNA extraction was performed by salting-out. By means of appropriate primers, polymerase chain reaction (PCR) amplification was carried out for the mtDNA fragment. Afterwards, the PCR products were digested using Nla III and Acc I restriction endonuclease enzymes for analysis of Restriction Fragment Length polymorphism (RFLP) in mtDNA T4216C and A4917G variations, respectively. With electrophoresis by means of 3% agarose gel and safe DNA gel stain, we imaged restriction products in a UV transilluminator. The accuracy of genotyping procedure was confirmed by sequencing the mtDNA fragment.

Results

No significant statistical difference in the frequency of the T4216C mtDNA variation was found between the patients (24 %) and the control subjects (21 %) (P = 0.61). Logistic regression analysis showed an OR of 1.1 (95% CI = 0.5-2.4). Moreover, there was no significant statistical difference in the frequency of mtDNA A4917G variation between the cases (11 %) and the controls (9 %) (P = 0.637). Logistic regression analysis revealed an odds ratio (OR) of 1.2 with 95% CI of 0.4-3.5.

Conclusion

The present study revealed no association between MS and T4216C variation in the ND1 mtDNA gene and A4917G variation in the mtDNA ND2 gene in the Iranian population.

Highlights

 

  • We investigated whether mtDNA T4216C and A4917G variations are associated with MS.
  • No association was found between mtDNA T4216C variation and MS.
  • No association was found between mtDNA A4917G variation and MS.

Keywords: Multiple Sclerosis, MS, Mitochondrial DNA, mtDNA variation, T4216C, A4917G, Iranian population.

1. Introduction

Multiple sclerosis (MS) is complex and unpredictable. An estimated 2,500,000 individuals throughout the world suffer from MS [1] . Since identification, MS has been the subject of intense and worldwide research; but its cause and cure remain elusive. Individuals aged 20-40 years are the most victims of MS [2] ; of these, women are more frequent [3] . Pathologically, MS is characterized by oligodendrocytosis and loss of myelin [4] and [5]. Not only does MS affect the myelin containing white matter of the CNS [6] , perhaps owing to blood-derived immune cells invading the CNS [7] , but it also affects the gray matter [8] , which would appear to be due to a neurodegenerative mechanism [9] . The conventional perspective views MS as an inflammatory disorder of the central nervous system (CNS) but recently and increasingly, MS is held to be the result of a neurodegenerative process [10] and [11] related to genetic susceptibility. Clinically, MS patients present with a broad spectrum of symptoms, including fatigue and sleepiness [12] , tremor [13] , spasticity [14] and [15], mood disturbance and depression [16] and [17], cognitive dysfunction and memory impairment [18] and [19], fear of progression [20] , dysarthria [21] and [22], dysphagia [23] and [24], bladder, bowel and sexual dysfunction [25] and [26], nystagmus [27] , and hypoesthesia [28] , all of which can be ascribed to genetically determined mitochondrial dysfunction. The recent literature includes numerous reports of treatments that allegedly modify the natural history of MS, albeit MS per se remains incurable. The McDonald criteria [29] and expanded disability status scale (EDSS) are used to assess MS status [30] . Laboratory tests, viz. Magnetic Resonance Imaging (MRI), Cerebrospinal Fluid (CSF) analysis [31] , and Optic Coherence Tomography (OCT) [32] supply crucial information concerning MS. The etiology of MS has not yet been fully clarified but involves genetic factors. Thus, the first- and second-degree families of an MS patient are exposed at higher risk of MS [33] , and nuclear and mitochondrial DNA (mtDNA) alterations may be involved in this susceptibility as is the case with altered MHC [34] and HLA [35], [36], and [37] nuclear genes that have been shown to be involved, although mutations of nuclear genes that encode for mitochondrial proteins also may be associated with MS. Gene alterations in the mitochondrial transcription factor A (TFAM), peroxisome proliferator-activated receptor gamma coactivator 1α (PGC1α), and nuclear respiratory factor 1 (NRF1) that serve a crucial role in the maintenance of the mitochondrial DNA (mtDNA) content, are known to be associated with MS [38] and [39]. Mitochondrial dysfunction is associated with axonal loss in MS [40] and [41] and mitochondrial dysfunction may stem from mitochondrial genetic alterations [42] . Compared to nuclear DNA, mtDNA is more prone to damage and mutation because of the exposure of mtDNA to the locally high mitochondrial oxidizing environment and the relatively poor repair mechanisms [43] . The damage is associated with inefficient ATP synthesis and generation of toxic waste products [43] . All cells may be affected by this phenomenon; but neural cells are particularly prone to damage, such that mtDNA mutations lead to neurological disorder as a cause or contributing factor [43] ; Leber’s Hereditary Optic Neuropathy (LHON) [44] , Myoclonus Epilepsy with Ragged Red Fibers (MERRF) [45] , Mitochondrial Encephalopathy with Lactic Acidosis and Stroke-like episode (MELAS) [46] , Alzheimer’s Disease (AD) [47] , Parkinson’s disease (PD) [48] , and MS [49] are among the disorders arising in this manner. Mitochondria are the cytoplasmic energy factories specialized in oxidative phosphorylation and adenosine triphosphate (ATP) production. The genome inside mitochondria, which is inherited only maternally [50] , is very small circular structure spanning about 16569 base pairs [51] , and undergoes a great deal of variation as a consequence of divergent evolution. MtDNA embodies 37 intronless genes, all of which are prerequisites of normal mitochondrial function. Thirteen of these genes provide instructions for producing enzymes essential for oxidative phosphorylation; the other genes, however, provide instructions for producing molecules called transfer RNA (tRNA) and ribosomal RNA (rRNA) [52] . Respiratory chain, which is responsible for oxidative phosphorylation, functions in mitochondria, includes 5 protein complexes. NADH Dehydrogenase (ND) 1, ND2, ND3, ND4, ND4l, ND5, and ND6 in complex I are encoded by mtDNA; however, all 4 subunits of complex II are encoded by nuclear genes. Cytocrome b in complex III, Cytochrome Oxidase (COX) I, COX II, and COX III in complex IV, A6 and A8 proteins in complex V are expressed by mtDNA. Complex I genes are the most vulnerable part of mtDNA [53] . With this in mind, genetics has emerged to become an important contributing factor in the pathogenesis of neurodegenerative diseases. One of the most significant current discussions in the etiology of MS is the role of mitochondrial dysfunction due to DNA variations or acquired mutations. Gene products of mitochondrial electron transfer chain decline in the brain while axonal damage occurs in MS [40] . And, cortical mitochondria show a decreased capacity in respiratory chain complex I and II [40] . In chronic active MS lesions, oxidative damage to mtDNA and impaired activity of complex I have been demonstrated [54] . Andalib et al. [49] reviewed mtDNA variations in MS in numerous populations. T4216C in mtDNA ND1 gene and A4917G variation in the mtDNA ND2 gene are common mtDNA variations found in MS patients [49] . T4216C mtDNA variation was demonstrated to be a predisposing marker of MS in a Bulgarian population [55] . In an American study, Kalman et al. [56] sequenced mtDNA in three patients with Devic's neuromyelitis optica (NMO) disease and MS and in spite of the fact that NMO was shown to be without pathogenic mtDNA point mutations, T4216C and A4917G mtDNA variations together were seen only in the one patient, notwithstanding T4216C mDNA variation in the other one. On the contrary, however, Vyshkana et al. [57] assessed variation candidates of complex I in American MS subjects relative to ethnically matched SLE subjects and controls by means of MassARRAY and found no association between MS and mtDNA T4216C and A4917G variations. And, the frequency of the mtDNA T4216C and A4917G variation was seen to higher than in the controls in German MS subjects [58] . Moreover, little is known about association of mtDNA T4216C and A4917G variations and MS in Iran. Thus, we designed the present study to test the hypothesis of an association of the mtDNA T4216C and A4917G variations to MS in an Iranian population.

2. Materials and Methods:

2.1. Study design, setting and participants:

A case-control design was used in the present study and a total number of 200 subjects involving 100 patients presenting with relapsing-remitting MS and 100 unrelated healthy controls were recruited. MS subjects were selected from several medical therapeutic centers of Tabriz University of Medical Sciences, Tabriz, Iran to avoid having similar risk factors. MS diagnosis was made according to McDonalad criteria [29] . Subjects with a family history of neurodegenerative or inherited diseases were excluded from the study. Control subjects were selected from healthy unrelated participants. Informed consent was obtained from each participant. In the present study, a case/control ratio of 1/1 was used; and to restrict the confounding effect, frequency and individual matchings were done in cases and controls for age and gender, respectively. The present study was approved by Ethical Committee of Tabriz University of Medical Sciences.

2.2. Variables, study size

By means of STATA software (version 12) with a test power of 80% and taking into account of study size of the previous studies, the study size was determined.

2.3. MtDNA genotyping

DNA was extracted by using a salting-out method [59] form blood sample collected from each subject. Quantitation of the extracted DNA samples, showing optimal DNA extraction, was assessed by the spectrophotometry. MtDNA was amplified by Polymerase Chain Reaction (PCR) using a thermocycler (Peqlab, Germany) for mtDNA by using appropriate forward and reverse primers ( Table 1 ). Using a gradient thermocycler (Peqlab, Germany), temperatures and cycling times were optimized for each DNA template target and primer pair. A previously used standard PCR protocol [60] and [61] was applied for all the reactions. The PCR products (10 μm) were digested with suitable restriction endonuclease enzymes which target sequences were influenced by the nucleotide changes (RFLP) ( Table 1 ). Electrophoresis of restriction products were carried out using 3% Agarose gel and DNA safe staining. Electrophoresis results were visualized by using a camera. DNA analyses were conducted blind to the diagnosis, and identities of subjects were known exclusively when the results were completed. PCR-RFLP findings were confirmed by sequencing. In order to confirm the PCR-RFLP results, several samples from each mtDNA variation were selected and purified with QIAquick SpinR Purification Kit and directly sequenced by Macrogen Inc. (Soth Korea), using an automated ABI Prism 3730XL DNA sequencer (Perkin-Elmer).

Table 1 Forward and reverse primers, utilized endonuclease and influenced target sequence for mtDNA T4216C and A4917G variations.

MtDNA variation Forward primer (5′-3′) Reverse primer (3′-5′) Endonuclease: Target sequence
T4216C CACCTCTGATTACTCCTGCC TAGGTTTGAGGGGGAATGCT Nla III: CATG/
A4917G CCAGAGGTTACCCAAGGCAC AGTAGTAGGGTCGTGGTGCT Mae I: C/TAG

2.4. Statistical methods

Data analysis was carried out using STATA software (Version 12.0). More precisely, Chi-square test was used and a P-value of less than 0.05 was considered statistically significant. Moreover, odds ratio (OR) along with 95% confidence interval (95% CI) was calculated by means of bivariate logistic regression analysis.

3. Results

3.1. Demography

We selected 100 cases with MS and 100 healthy unrelated control subjects. A ratio of 1 case per 1 control was applied to this study. To restrict confounding effect of age, frequency matching was carried out in 60% of cases and controls aged 20-35 years. Similarly, individual matching was carried out for gender and consequently 63 females and 37 males were selected in, both, case and control groups. Table 2 tabulates demographic summary of the cases and controls.

Table 2 demographic summery of case and control groups.

  Case group Control group
Age (mean ± SD) 32.47 ± 8.13 y 30.24 ± 15.49 y
Gender F = 63(63%) M = 37(37%) F = 63(63%) M = 37(37%)

3.2. Analysis of mtDNA T4216C and A4917G variations

Electrophoretic analysis of the mtDNA T4216C ( Fig. 2 ) showed that the variation was present in 24 out of 100 cases (24%) and 21 out of 100 controls (21%) ( Fig. 3 ). The Chi square analysis showed no significant association between the MS and T4216C variation (P = 0.61) and bivariate logistic regression analysis showed an OR of 1.1 ( Table 3 ). The PCR-RFLP results of mtDNA T4216C variation were confirmed by the sequencing ( Fig. 4 ). Electrophoresis analysis of the mtDNA A4917G variation ( Fig. 5 ) revealed that the variation was present in 11 of 100 the MS subjects (11%), while it was seen in 9 of 100 the healthy controls (9%) ( Fig. 6 ). Consequently, the Chi square analysis revealed no significant association between the MS and A4917G variation (P = 0.637); even so, bivariate logistic regression analysis showed an OR of 1.24 ( Table 1 ). The PCR-RFLP results of mtDNA A4917G variations were confirmed by the sequencing ( Fig. 7 ). No heteroplasmy was observed for both mtDNA variations. (See Fig. 1 .)

gr1

Fig. 1 flowchart of the study process.

gr2

Fig. 2 Comparison of electrophoresis of PCR and restriction products for mtDNA T4216C variation (Homoplasmic normal variant, Homoplasmic mtDNA 4216C variant, Undigested PCR product, and DNA ladder, left to right, respectively).

gr3

Fig. 3 Comparison of allelic frequencies between case and control groups for mtDNA T4216C variation.

Table 3 statistical significance, OR, and 95% CI between case and control groups for mtDNA T4216C and A4917G variations.

Variation Cases N (%) Controls N (%) P value OR 95% CI
T4216C 24/100 (0.24) 21/100 (0.21) 0.611 1.1 0.5- 2.4
A4917G 11/100 (0.11) 9/100 (0.09) 0.637 1.2 0.4-3.5
gr4

Fig. 4 Comparison of the sequencing results in the normal (a) and mtDNA T4216C (b) variants.

gr5

Fig. 5 Comparison of electrophoresis of PCR and restriction products for mtDNA A4917G (DNA ladder, Undigested PCR product, Homoplasmic 4917G variant, and Homoplasmic normal variant, left to right, respectively).

gr6

Fig. 6 Comparison of allelic frequencies between case and control groups for mtDNA A4917G variation.

gr7

Fig. 7 Comparison of the sequencing results for mtDNA A4917G variation.

4. Discussion

We assessed the association of mtDNA T4216C and A4917G variations with MS in an Iranian population and found the variation in 24 of 100 cases (24%) and 21 of 100 controls (21%). Withal, 11 out of 100 MS patients (11%) and 9 out of 100 healthy controls (9%) showed the mtDNA A4917G variation. In the present study, no significant association was seen between mtDNA T4216C and A4917G variations and MS.

Attempts to establish the association of the mtDNA T4216C and A4917G variations with MS. The published correlations in different populations are rather controversial. The present study produced results which corroborate those of Yu et al. [62] , assessing six European MS case-control cohorts including 5,000 participants and three well-matched cohorts. The authors assessed seven common and potentially functional mtDNA variations and found no association between MS and the mtDNA T4216C variation. The authors found mtDNA T4216C variation in 17.7% of the cases (n = 417) and 13.7% of the controls (n = 510) in the Spanish cohort and consequently no significant association (P = 0.101, OR = 1.36, 95% CI = 0.93–1.97). In the Norwegian cohort, mtDNA T4216C variation was present in 21.5% of the cases (n = 390) and 15.8% of the controls (190) with no significant association (P = 0.119, OR = 1.46, 95% CI = 0.91–2.40). In the German cohort, the mtDNA T4216C variation was demonstrated in 22.8% of cases (n = 285) and 23% of the controls (n = 382) and no significant association (P = 1, OR = 0.98, 95% CI = 0.67–1.44) was found. The pooled analysis also failed to show any association of mtDNA T4216C variation with MS (P = 0.078, OR = 1.06, 95% CI = 0.70–1.01) [62] . Vyshkina et al. [57] analyzed several mtDNA variations in Caucasian MS subjects and controls by using Sequenom MassARRAY System and reported no association between mtDNA T4216C variation and MS; however, mtDNA A4917G variation was associated with MS (P = 0.006). Chalmers et al. [63] investigated 175 unrelated MS patients and 233 healthy control subjects for mtDNA T4216C and A4917G variations by using RFLP analysis and demonstrated that these variations were at a similar frequency in the case and control subjects in UK and therefore not associated with MS.

T4216C mtDNA variation was seen to be a predisposing marker for MS in a study by Mihailova et al. [55] . The authors analyzed 58 unrelated Bulgarian subjects with relapsing–remitting MS and 104 healthy controls for secondary LHON mutations (np 4216, 14798, and 13708) and 14 main mtDNA variations showing European haplogroups. The common haplogroup-associated variations were assessed by RFLP and a significant difference was seen in T4216C base change between the MS subjects and the controls. It was also demonstrated that 21 out of the 58 subjects (36.2%) carried the T4216C variation, notwithstanding 11.3% in the controls (P = 0.01; OR = 4.38). No association was seen between G13708A, T14798C variations and MS. G13708A was seen in 4 controls and 3 cases. T14798C variations was found to be less in MS subjects (10%) than in the controls (6.9%) [55] . Penissen-Besnier et al. [64] studied mtDNA T4216C and A4917G variations in 75 unrelated Caucasian subjects with the relapsing–remitting or primary progressive MS, and 75 age-, gender- and ethnic origin-matched controls by using RFLP and sequencing and the proportion of people having these secondary LHON mutations was equal (27%) in the two groups [64] . In a German study, Mayr-Wohlfart et al. [58] studied mtDNA in 100 MS subjects with failures in visual evoked potential (VEP) and 100 controls by RFLP and sequencing and found that mtDNA T4216C variation frequency in MS subjects (18%) was higher than in the controls (11%); even so, there was a high frequency of the A4917T variation in MS cases (11%), compared to controls (4%) [58] . Elsewhere, an American study demonstrated certain sets of mtDNA variations with association with MS [65] . The authors assessed 8 variations in MS by RFLP and sequencing and found that class I LHON mutations with primary pathogenic significance for blindness were not present in the MS subjects. Class II LHON mutations with unknown pathogenic significance were also demonstrated to be more in the MS subjects than in the controls, particularly at np 4216 and its associated simultaneous mutations [65] . Eleven out of the 53 cases, constituting 20.8% of the subjects, carried at least two (4216 and 4917 or 13,708) or three (4216, 13,708, 15,257) simultaneous class II LHON mutations; albeit 7 out of the 74 controls, constituting 9.5% of the controls, carried simultaneous mutations (P = 0.036) [65] . Furthermore, the mutations were not found to be correlated with the severity of visual loss in either LHON or MS; however, such mutations were as a consequence of random selection in the MS subjects [65] . Another American study analyzed mtDNA variations within patients with Devic's neuromyelitis optica (NMO) disease and MS in three spinal cord specimens and found that NMO lacked pathogenic mtDNA point mutations [56] . Nonetheless, mtDNAT4216C and T14798C variations was found in the one of the patients, notwithstanding mtDNA T4216C in the other one [56] .

In conclusion, the present study suggests lack of association of the mtDNA T4216C variation in mitochondrial ND1 gene and mtDNA A4917T in mitochondrial ND2 gene with MS. Altogether, inasmuch as the degree of involvement of such mtDNA changes in pathogenesis of MS is a less divulged topic, these results need to be cautiously interpreted and more local investigations in different populations would be of value.

Conflict of Interest

None.

Acknowledgment

We thank all the staffs involved in this study.

References

  • [1] J.A. Wollin, P.M. Yates, L.J. Kristjanson. Supportive and palliative care needs identified by multiple sclerosis patients and their families. Int J Palliat Nurs. 2006;12:20-26
  • [2] K. Mutch. Information for young people when multiple sclerosis enters the family. Br J Nurs. 2005;14:758-760
  • [3] P. Duquette, J. Pleines, M. Girard, L. Charest, M. Senecal-Quevillon, C. Masse. The increased susceptibility of women to multiple sclerosis. Can J Neurol Sciences J Can Sci Neurol. 1992;19:466
  • [4] A. Minagar, E.G. Toledo, J.S. Alexander, R.E. Kelley. Pathogenesis of brain and spinal cord atrophy in multiple sclerosis. J Neuroimaging. 2004;14:5S-10S
  • [5] M.J. Sá. Physiopathology of symptoms and signs in multiple sclerosis. Arq Neuropsiquiatr. 2012;70:733-740
  • [6] A.C. Lúcio, M.C. Perissinoto, R.A. Natalin, A. Prudente, B.P. Damasceno, C. D’ancona. A comparative study of pelvic floor muscle training in women with multiple sclerosis: its impact on lower urinary tract symptoms and quality of life. Clinics (Sao Paulo). 2011;66:1563-1568
  • [7] L. Steinman. Multiple sclerosis: a two-stage disease. Nat Immunol. 2001;2:762-763
  • [8] I. Pirko, C.F. Lucchinetti, S. Sriram, R. Bakshi. Gray matter involvement in multiple sclerosis. Neurology. 2007;68:634-642
  • [9] D. Centonze, L. Muzio, S. Rossi, R. Furlan, G. Bernardi, G. Martino. The link between inflammation, synaptic transmission and neurodegeneration in multiple sclerosis. Cell Death Differ. 2009;17:1083-1091
  • [10] W. Brück, C. Stadelmann. Inflammation and degeneration in multiple sclerosis. Neurol Sci. 2003;24:s265-s267
  • [11] J.M. Frischer, S. Bramow, A. Dal-Bianco, C.F. Lucchinetti, H. Rauschka, M. Schmidbauer, et al. The relation between inflammation and neurodegeneration in multiple sclerosis brains. Brain. 2009;132:1175-1189
  • [12] B. Stanton, F. Barnes, E. Silber. Sleep and fatigue in multiple sclerosis. Mult Scler. 2006;12:481-486
  • [13] M. Koch, J. Mostert. Tremor in multiple sclerosis. J Neurol. 2007;254:133-145
  • [14] B. Bussel, O.R. Neris, L. Mailhan. Spasticity and multiple sclerosis. Rev Neurol. 2001;157:1041
  • [15] M. Barnes, R. Kent, J. Semlyen, K. McMullen. Spasticity in multiple sclerosis. Neurorehabil Neural Repair. 2003;17:66-70
  • [16] R. Siegert, D. Abernethy. Depression in multiple sclerosis: a review. J Neurol Neurosurg Psychiatry. 2005;76:469-475
  • [17] C. Lebrun, M. Cohen. Depression in multiple sclerosis. Rev Neurol. 2009;165:S156-S162
  • [18] S.M. Rao, G.J. Leo, L. Bernardin, F. Unverzagt. Cognitive dysfunction in multiple sclerosis. I. Frequency, patterns, and prediction. Neurology. 1991;41:685-691
  • [19] M. Carroll, R. Gates, F. Roldan. Memory impairment in multiple sclerosis. Neuropsychologia. 1984;22:297-302
  • [20] M. Ghojazadeh, M. Taghizadeh, S. Abdi, S. Azami-Aghdash, S. Andalib, M. Farhoudi. Fear of Disease Progression in Patients with Multiple Sclerosis: Associations of Anxiety, Depression, Quality of Life, Social Support and Knowledge. J Clin Res Gov. 2014;3:141-146
  • [21] F.L. Darley, J.R. Brown, N.P. Goldstein. Dysarthria in multiple sclerosis. J Speech Lang Hear Res. 1972;15:229-245
  • [22] L. Hartelius, B. Runmarker, R.N. O, O. Andersen. Prevalence and characteristics of dysarthria in a multiple-sclerosis incidence cohort: relation to neurological data. Folia Phoniatr Logop: Off Organ Int Assoc Logop Phoniatr (IALP). 1999;52:160-177
  • [23] P. Calcagno, G. Ruoppolo, M. Grasso, M. De Vincentiis, S. Paolucci. Dysphagia in multiple sclerosis–prevalence and prognostic factors. Acta Neurol Scand. 2002;105:40-43
  • [24] A. De Pauw, E. Dejaeger, B. D'hooghe, H. Carton. Dysphagia in multiple sclerosis. Clin Neurol Neurosurg. 2002;104:345-351
  • [25] A. Bakke, K. Myhr, M. Grønning, H. Nyland. Bladder, bowel and sexual dysfunction in patients with multiple sclerosis–a cohort study. Scand J Urol Nephrol Suppl. 1996;179:61-66
  • [26] K.S. Hawker, E.M. Frohman. Bladder, bowel, and sexual dysfunction in multiple sclerosis. Curr Treat Options Neurol. 2001;3:207-213
  • [27] J. Barton, T.A. Cox. Acquired pendular nystagmus in multiple sclerosis: clinical observations and the role of optic neuropathy. J Neurol Neurosurg Psychiatry. 1993;56:262-267
  • [28] R.N. Kostoff, M.B. Briggs, T.J. Lyons. Literature-related discovery (LRD): Potential treatments for multiple sclerosis. Technol Forecast Soc Chang. 2008;75:239-255
  • [29] C.H. Polman, S.C. Reingold, B. Banwell, M. Clanet, J.A. Cohen, M. Filippi, et al. Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria. Ann Neurol. 2011;69:292-302
  • [30] J.F. Kurtzke. Rating neurologic impairment in multiple sclerosis an expanded disability status scale (EDSS). Neurology. 1983;33:1444
  • [31] A. Gajofatto, M. Calabrese, M.D. Benedetti, S. Monaco. Clinical, MRI, and CSF Markers of Disability Progression in Multiple Sclerosis. Dis Markers. 2013;35:687-699
  • [32] M. Talebi, M. Nikanfar, R. Sorkhabi, E. Sharifipour, M. Bahrebar, A. Kiavar, et al. Optic coherence tomography findings in relapsing-remitting multiple sclerosis patients of the northwest of Iran. Iran J Neurol. 2013;12:81-88
  • [33] H. Carton, R. Vlietinck, J. Debruyne, J. De Keyser, M.-B. D'Hooghe, R. Loos, et al. Risks of multiple sclerosis in relatives of patients in Flanders, Belgium. J Neurol Neurosurg Psychiatry. 1997;62:329-333
  • [34] J. Haines, M. Ter-Minassian, A. Bazyk, J. Gusella, D. Kim, H. Terwedow, et al. A complete genomic screen for multiple sclerosis underscores a role for the major histocompatability complex. Nat Genet. 1996;13:469-471
  • [35] J. Hillert, O. Olerup. Multiple sclerosis is associated with genes within or close to the HLA‐DR‐DQ subregion on a normal DR15, DQ6, Dw2 haplotype. Neurology. 1993;43:163
  • [36] C. Mayorga, P. Bsc. DQB1* 0602 allele shows a strong association with multiple sclerosis in patients in Malaga, Spain. J Neurol. 2004;251:440-444
  • [37] A. Caballero, S. Alvés‐León, R. Papais‐Alvarenga, O. Fernandez, G. Navarro, A. Alonso. DQB1* 0602 confers genetic susceptibility to multiple sclerosis in Afro‐Brazilians. Tissue Antigens. 1999;54:524-526
  • [38] C.T. Moraes. What regulates mitochondrial DNA copy number in animal cells?. Trends Genet. 2001;17:199-205
  • [39] J.E. Curran, M.P. Johnson, T.D. Dyer, H.H. Göring, J.W. Kent, J.C. Charlesworth, et al. Genetic determinants of mitochondrial content. Hum Mol Genet. 2007;16:1504-1514
  • [40] R. Dutta, J. McDonough, X. Yin, J. Peterson, A. Chang, T. Torres, et al. Mitochondrial dysfunction as a cause of axonal degeneration in multiple sclerosis patients. Ann Neurol. 2006;59:478-489
  • [41] H. Andrews, P. Nichols, D. Bates, D. Turnbull. Mitochondrial dysfunction plays a key role in progressive axonal loss in multiple sclerosis. Med Hypotheses. 2005;64:669-677
  • [42] K. Inoue, K. Nakada, A. Ogura, K. Isobe, Y.-i. Goto, I. Nonaka, et al. Generation of mice with mitochondrial dysfunction by introducing mouse mtDNA carrying a deletion into zygotes. Nat Genet. 2000;26:176-181
  • [43] G.W. Glazner. The role of mitochondrial genome mutations in neurodegenerative disease. Adv Cell Aging Gerontol. 1999;3:313-354
  • [44] M. Houshmand, F. Sharifpanah, A. Tabasi, M.H. SANATI, M. Vakilian, S. Lavasani, et al. Leber's hereditary optic neuropathy: the spectrum of mitochondrial DNA mutations in Iranian patients. Ann N Y Acad Sci. 2004;1011:345-349
  • [45] G. Silvestri, C. Moraes, S. Shanske, S. Oh, S. DiMauro. A new mtDNA mutation in the tRNA (Lys) gene associated with myoclonic epilepsy and ragged-red fibers (MERRF). Am J Hum Genet. 1992;51:1213-1217
  • [46] M. Tanaka, H. Ino, K. Ohno, T. Ohbayashi, S.-i. Ikebe, T. Sano, et al. Mitochondrial DNA mutations in mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). Biochem Biophys Res Commun. 1991;174:861-868
  • [47] M. Grazina, J. Pratas, F. Silva, S. Oliveira, I. Santana, C. Oliveira. Genetic basis of Alzheimer's dementia: role of mtDNA mutations. Genes Brain Behav. 2006;5:92-107
  • [48] S. Andalib, M.S. Vafaee, A. Gjedde. Parkinson's disease and mitochondrial gene variations: A review. J Neurol Sci. 2014;346:11-19
  • [49] S. Andalib, M. Talebi, E. Sakhinia, M. Farhoudi, H. Sadeghi-Bazargani, A. Motavallian, et al. Multiple sclerosis and mitochondrial gene variations: A review. J Neurol Sci. 2013;330:10-15
  • [50] R.E. Giles, H. Blanc, H.M. Cann, D.C. Wallace. Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci. 1980;77:6715-6719
  • [51] P. Awadalla, A. Eyre-Walker, J.M. Smith. Linkage disequilibrium and recombination in hominid mitochondrial DNA. Science. 1999;286:2524-2525
  • [52] P. Chinnery, E. Schon. Mitochondria. J Neurol Neurosurg Psychiatry. 2003;74:1188-1199
  • [53] G. Richter, A. Sonnenschein, T. Grünewald, H. Reichmann, B. Janetzky. Novel mitochondrial DNA mutations in Parkinson's disease. J Neural Transm. 2002;109:721-729
  • [54] F. Lu, M. Selak, J. O’Connor, S. Croul, C. Lorenzana, C. Butunoi, et al. Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronic active lesions of multiple sclerosis. J Neurol Sci. 2000;177:95-103
  • [55] S. Mihailova, M. Ivanova, L. Quin, E. Naumova. Mitochondrial DNA variants in Bulgarian patients affected by multiple sclerosis. Eur J Neurol. 2007;14:44-47
  • [56] B. Kalman, R.N. Mandler. Studies of mitochondrial DNA in Devic's disease revealed no pathogenic mutations, but polymorphisms also found in association with multiple sclerosis. Ann Neurol. 2002;51:661-662
  • [57] T. Vyshkina, A. Sylvester, S. Sadiq, E. Bonilla, J.A. Canter, A. Perl, et al. Association of common mitochondrial DNA variants with multiple sclerosis and systemic lupus erythematosus. Clin Immunol. 2008;129:31-35
  • [58] U. Mayr‐Wohlfart, C. Paulus, A. Henneberg, G. Rödel. Mitochondrial DNA mutations in multiple sclerosis patients with severe optic involvement. Acta Neurol Scand. 1996;94:167-171
  • [59] S. Miller, D. Dykes, H. Polesky. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215
  • [60] A. Motavallian, S. Andalib, G. Vaseghi, H. Mirmohammad-Sadeghi, M. Amini. Association between PRO12ALA polymorphism of the PPAR-γ2 gene and type 2 diabetes mellitus in Iranian patients. Indian J Hum Genet. 2013;19:239-244
  • [61] S. Andalib, G. Vaseghi, A. Motavallian, H.M. Sadeghi, A. Eshraghi, M. Amini, et al. Association of Polymorphism of Ser311cys Paraoxonase-2 Gene with Type 2 Diabetes Mellitus in Iran. Int J Prev Med. 2013;4:517-522
  • [62] X. Yu, D. Koczan, A.-M. Sulonen, D.A. Akkad, A. Kroner, M. Comabella, et al. mtDNA nt13708A variant increases the risk of multiple sclerosis. PLoS One. 2008;3 [e1530]
  • [63] R.M. Chalmers, N. Robertson, D.A.S. Compston, A.E. Harding. Sequence of mitochondrial DNA in patients with multiple sclerosis. Ann Neurol. 1996;40:239-243
  • [64] I. Penisson-Besnier, C. Moreau, C. Jacques, J. Roger, F. Dubas, P. Reynier. Multiple sclerosis and Leber's hereditary optic neuropathy mitochondrial DNA mutations. Rev Neurol. 2001;157:537-541
  • [65] B. Kalman, F. Lublin, H. Alder. Mitochondrial DNA mutations in multiple sclerosis. Mult Scler. 1995;1:32-36

Footnotes

a Neurosciences Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran

b Division of Regenerative Medicine, School of Medicine, Faculty of Medical and Human Sciences, the University of Manchester, UK & Department of Medical Genetics, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

c Department of Public Health Sciences, Karolinska Institute, Stockholm, Sweden & Trauma Epidemiology and Road Traffic Injury Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

d Department of Neuroscience and Pharmacology, University of Copenhagen, Denmark

Corresponding author. Tel./fax: + 98 4133340730.

⁎⁎ Corresponding author. Tel./fax: + 98 4133370684.


Search this site

Stay up-to-date with our monthly e-alert

If you want to regularly receive information on what is happening in MS research sign up to our e-alert.

Subscribe »

About the Editors

  • Prof Timothy Vartanian

    dsc_0787_400x400.jpg Timothy Vartanian, Professor at the Brain and Mind Research Institute and the Department of Neurology, Weill Cornell Medical College,...
  • Dr Claire S. Riley

    headshotcsr1_185x250.jpg Claire S. Riley, MD is an assistant attending neurologist and assistant professor of neurology in the Neurological Institute, Columbia...
  • Dr Rebecca Farber

    picforelsevier.jpg Rebecca Farber, MD is an attending neurologist and assistant professor of neurology at the Neurological Institute, Columbia University, in...

This online Resource Centre has been made possible by a donation from EMD Serono, Inc., a business of Merck KGaA, Darmstadt, Germany.

Note that EMD Serono, Inc., has no editorial control or influence over the content of this Resource Centre. The Resource Centre and all content therein are subject to an independent editorial review.

The Grant for Multiple Sclerosis Innovation
supports promising translational research projects by academic researchers to improve understanding of multiple sclerosis (MS) for the ultimate benefit of patients.  For full information and application details, please click here

Journal Editor's choice

Recommended by Prof. Brenda Banwell

Causes of death among persons with multiple sclerosis

Gary R. Cutter, Jeffrey Zimmerman, Amber R. Salter, et al.

Multiple Sclerosis and Related Disorders, September 2015, Vol 4 Issue 5